Veckoschema!

Hej på er! Nu har vardagen dragit igång igen så dags att börja skriva veckoschema:

Måndag: I måndags var det upprop och sedan skoldag mellan nio till ett. Sedan hade jag träning efter det, styrka och 400meters intervaller.

Tisdag: Idag var vi inne i Stockholm med skolan, stadsorientering stod på schemat. Efter det var det vanlig tisdagsträning, sprint intervaller.

Onsdag: Imorgon åker jag ut till stallet direkt efter skolan och hjälper till, eventuellt rida.

Torsdag: Direkt ut till stallet efter skolan, rider pass för Cornelia med Norton!

Fredag: Ut till stallet direkt efter skolan och troligtvis rida, sedan ska jag äta middag hos Sandra och sova över!

Lördag: Äntligen lördag, har sett fram emot det, stallet hela dagen! Rider Norton för Sandra på morgonen

Söndag: Tävling i Norrtälje, LB:1 och LA:1, taggataggataggatagga!!!

// Jonna

IMG_1557 2

Resten av veckan!

Det som är kvar av denna vecka kommer se ut såhär för mig: 👇🏼

Onsdag: Åker förmodligen ner till stallet och hjälper till i grupperna.

Torsdag: Jag rider vanlig lektion för Cornelia med Barbie.

Fredag: Tänkte åka till gymet och träna. 🏋🏼‍♀️💪🏼

Lördag: Först vanlig lektion för Sandra på morgonen. Sedan stalljobb rästen av dagen.

Söndag: Tävling i Norrtälje, LB:1 och LA:1! Så taggad 💪🏼💪🏼💪🏼

Det kan nog ändra sig lite grann men ungefär då så 👆🏼

//Clara

Dagens dressyr!

Hej!!

Idag har jag och Moa fortfarande haft sommarlov, (till skillnad från Jonna och Emelie 😆) så vi fick en till dag i stallet! ✌🏼

Jag red privatlektion vid 12:30, det gick helt ok. Allt blir bra bara hon lyssnar framåt.

Imorrn börjar även vi skolan, med 2 timmars lektion från 13 – 15. Därför åker jag nog ner till stallet och fixar lite på morgonen.

//Clara

gårdagens ridpass

Igår red jag, Moa och Jonna för Sandra.

I början av passet kändes hon väldigt lång och stark. I vänstervarvet kändes hon mjuk och fin, men i höger så blir både jag och DD starka och tappar yttersidan. Ganska svårt att beskriva men jaja. På slutet blev hon jätte fin.

Idag har även skolan börjat och det är bara tillbaka till vardag. Tur var vi bara i skolan för upprop och lite till så vi sluta kl 11. Imorgon och på onsdag har vi mentors dagar. På söndag ska jag även tävla i Norrtälje så mer om mitt upplägg kommer senare.

//Emelie

D

 

Sommaren 2017

Här kommer ett inlägg om min sommar, i bilder.

IMG_2405IMG_1752IMG_1794IMG_1799D0965B8D-CFA2-4085-A036-CA2D0B8D51C6IMG_1700IMG_1699IMG_2001IMG_2332IMG_2329IMG_3442IMG_1245IMG_1523IMG_2393IMG_2535IMG_2548 2

När man ser tillbaka så här så har jag faktiskt hunnit med väldigt mycket den här sommaren! Jag och Norton har till exempel båda två lärt oss mycket mer om det här med tömkörning, även har vi kommit ett steg framåt när det kommer till ridningen. Så för att sammanfatta sommaren 2017 så har den faktiskt varit bra, men såklart lite för kort, men det är den väl alltid.

// Jonna

Dagen ☀️

Idag red jag Barbie ett pass på banan. Sedan åkte jag iväg med min familj för att se när min lilla syster spelade fotbolls match. Påväg hem hann vi även in på Grangården.

Passet med Barbie kändes inte helt bra alla gånger. I skritten så gick hon på bra och lyssnade bra framåt. Men i traven hade jag inte alls samma känsla. Galoppen gick dock mycket bättre då hon svarade bra för mina hjälper.

På granngården passade jag på att kitta upp mig med nya tävlings borstar inför hösten! ✌🏼

//Clara

 (Bilderna har börjat strula lite nu så det kommer upp bilder senare)

Sista sommarlovsdagen

Ja idag var det sista sommarlovsdagen. Känns lite sorgligt att skriva det faktiskt, det har gått sååå fort. Svish sa det och så har nio veckor gått. Men ändå så har jag hunnit med väldigt mycket.

Sista dagen spenderades såklart i stallet. Åkte ut efter lunch och pysslade lite, sedan red jag runt tre. Sandra var med nere vid ridbanan och hjälpte oss lite. Passet gick helt ok, som vi aldrig säger annars hehe. Bra känsla i traven, men måste jobba på at det ska hända saker varje steg. Jag får liksom inte rida en kortsida utan att det har hänt något. I galoppen fick jag först en halvbra känsla men den blev bättre mot slutet.

IMG_2535

Nej nu måste jag snart sova och ladda upp inför att börja nian, nu blir vi äldst på skolan✌🏻😉

// Jonna

Sista ridlägerdagen!

Hej!

Idag var det SISTA ridlägerdagen för denna sommar. Måste säga att sommarn har gått vääldigt fort. Det är faktiskt lite sorgligt att sommarlovet och ridlägerna är slut för i år. 😢

Men, men det är kul att hösten drar igång med alla tävlingar igen! Jag är såå taggad 💪🏼💪🏼.

Här kommer kort om idag och igår. Igår red jag Tulle på banan. Han är en av verksamhetens stor hästar. Faktiskt första gången jag red dressyr på honom. Han är lite klurig men efter ett tag vart han väldigt fin!

Imorrse vart det en uteritt med Barbie. Sedan var det som sagt avslutning med sommarens sista ridläger gäng!

//Clara

De senaste dagarna!

Halloj! Här kommer en snabb uppdatering från de senaste dagarna:

I onsdags red jag Norton ett pass på banan för Sandra. Vi jobbade på med samma fokus, att han ska vara kvick och aktiv, mycket bättre redan från start idag.

Igår red jag Cris’son efter lägret. Kul att rida honom då jag inte ridit honom på ett bra tag. Riktigt rolig häst att rida! Vi har saker kvar att jobba på men det blir bättre! Han blir gärna lite trippig i traven så det försöker vi jobba bort. I galoppen får jag en väldigt bra känsla, men ibland blir han nästan lite överambitiös och försöker fatta galoppen före mig. Hoppade även upp på Sture och red några varv på i slutet. Haha snacka skillnad om att först sitta på Cris’son som är en hyfsat stor storhäst och sedan hoppa ner till Sture som är en B-ponny, fördel med att inte vara så lång!!☝🏻

Idag red jag ut Norton på morgonen, nu får han vila under lördagen så får vi se hur söndagen ser ut.

IMG_2405

// Jonna

Snabb ubdatering!

Heej!

Gårdagens pass med Barbie hade samma  fokus, som i tisdags. Att hon ska lyssna framåt på mig varje steg.

Efter passet i tisdags så märktes det lite skillnad, att hon lyssnade bättre. Så nu är vi taggade till tusen på tävlings säsongen!💪🏼

Idag vilar hon och jag ska rida en annan häst från verksamheten i eftermiddag.

Igår fyllde jag och Jonna 70 höpåsar under  eftermiddagen på vääldigt kort tid. 😅 Slå det om ni kan 😆😉

//Clara