Heeeej

Hej alla!! Nu är jag tillbaka!

Igår kom jag hem från Polen. Eller rättare sagt imorse, planet var försenat så vi landade halv ett på natten. Har levt fyra dagar utan wifi så det är därför jag inte har kunnat uppdatera något här under veckan.😂

Har såå mycket att berätta för er, allt om Auschwiz, Birkenau, Krakow, saltgruvan, ja allt som hänt dessa fyra dagar! Tänker att jag skriver lite separata inlägg om det, speciellt Auschwitz tror jag behöver ett långt inlägg. Så mycket minnen och bilder som borrat sig fast inom mig därifrån.

Idag har vi varit lediga efter resan och vad tror ni jag gjorde då klockan sju imorse? Jo gick upp och åkte till stallet såklart! Det tror jag i och för sig att ni hade kunnat lista ut… Var faktist förvånansvärt pigg imorse efter fem timmars sömn, troligtvis eftersom jag skulle få ut och träffa Norton.

Dagen började med att jag och Cornelia hjälptes åt att mocka stallet. Därefter hjälpte jag till att göra iordning lite hästar inför ridning och lite annat fix innan jag red Sture. Det gick ganska bra. Han var lite rädd för ett hörn men efter ett tag gick det bra, ni vet det finns ju ibland lite spöken i vissa hörn. Annars lyssnade han jättebra, duktig liten bebis! Efter det fixade vi klart det sista i stallet innan vi åt lunch. Därefter har vi skottat och planat till hela ridbanan. Jobbigt!! Här behövs inga gymkort, kom till stallet och jobba istället!

Efter det var det äntliiigen dags att hoppa upp och rida Norton igen. Snälla Cornelia har ridit honom lite medan jag har varit borta, perfekt då (som jag kanske nämnt tidigare) hon har ridit honom i flera år innan jag började rida honom. Hon kan honom utan och innan och vet exakt hur hon ska göra med honom. Red privatlektion för Cornelia så fick jättebra hjälp med hur jag ska få det där trycket fram till bettet. Har känt innan att det blir lite dåligt stöd och lite flabbigt ibland men nu vet jag hur jag ska tänka för att få det bra. Red även igenom L:C1 som jag ska tävla på söndag! taggataggataggatagga!!!!! Efter ridpasset friserade jag till Norton lite och sen packade jag ihop alla tävlingsgrejjor för söndag.

IMG_8266

Nu har jag landat hemma i soffan med tacos, skööönt.

Imorgon är det en vanlig lördag med pass för Sandra på morgonen och sen stalljobb.

IMG_8072 IMG_8104

Här kommer ett smakprov från Polen, håll er uppdaterade för inlägg om resan nu!

// Jonna

Onsdag & Torsdag 🐴🐴

Hej!

Igår, Onsdag skulle jag ha hjälpt till att rida en häst som står på ett anat stall som ni vet. Men det vart inte riktigt så, för han hade gjort illla sitt ena bakben. Därför blev det en halvtimmes promenad och kyla ben istället 😉. Tråkigt, tråkigt men vi får hoppas på att det blir bättre snabbt.

Idag hade vi ett ganska stort historia prov på hela antiken i skolan! Därför var det bara att sitta och plugga efter stallet igår. Men jag klarade provet bättre än vad jag hade trott faktiskt. Det är väldigt skönt att ha gjort provet och slippa tänka på det.

Idag var det som vanligt ett pass för Cornelia som gällde. Vi tränade mycket LC:1 delar inför söndag och division tre laget! Alltså blev det mycket fokus på övergångar och hörnpaseringar. Barbie var ganska seg och lysnade inte så bra för hjälperna. Men hon var fin i formen och hörnpasseringarna vart bra.

Jag och Emelie hann packa i ordning det mesta inför söndagen. Tyvärr hittade vi väldigt mycket rottbajs blad vissa saker som vi inte andvänt på ett tag. Det var riktigt äckligt och vidrigt, så mycket var bara att kasta i tvätten! 💩

Inga foton idag heller från passet, men här är två på Barbie efteråt. Det snöade utanför ridhuset under hela passet så nu är det vitt på marken igen ❄️. April-vädret är redan igång då vi nästan hade 20 plus i måndags och nu är det snö! ☀️🌨

//Clara och Barbie

IMG_5612 IMG_5616

Min helg!

Hej!

IMG_5436Här kommer ett litet inlägg om min helg. Min helg har varit väldigt rolig. Den har kanske varit den bästa på länge. Min helg började i fredags efter skolan. Jag började med att träna ett dressyrpass för Sandra på Poseidon. Efter jag hade ridit så hade vi tömkörningskurs vilket var jätteroligt och väldigt lärorikt! Ja lärde mig massor. Efter kursen så åt vi pizza hos Sandra. Efter vi hade ätit pizza så sov Emelie och Clara över oss mig. På lördagen gick vi upp tidigt för att släppa ut hästarna och sedan var det fortsättning på tömkörningskursen. Men i lördags så fick vi tömköra våra egna hästar vilket var ännu roligare. Vi visste inte om Poseidon hade blivit tömkörd förut men han sköte sig utmärkt och det verkade som att han kunde det här med tömkörning. Så en stor stjärna till Poseidon. Efter kursen så var jag och Emelie tvungna att åka på dop till våran nya kusin. Efter dopet så åkte jag vidare för att se på landskampen
Sverige -Vitryssland med mitt fotbollslag. Efter landskampen så åkte vi till våran hemma plan där vi sov i en gympasal. På söndagen så vilade Poseidon då jag hade två fotbollsmatcher. En på förmiddagen och en på eftermiddagen. Efter matcherna så åkte jag hem och pluggade lite och sedan åt jag middag! Så här har min helg sett ut.

//Moa

Dressyr pass!

 

 

Hej!

idag blev det ett pass på banan. Barbie var väldigt fin, men blev lite krämig emellanåt. Ena gången var det full fart framåt medans den andra så var det helt tvärt om. Jag måste träna mer på att slappna av och vara lätt i handen även fast hon blir stark ibland.

Har inga bilder från ridpasset men här kommer det några på Barbie som är tagna efter passet. 👇🏼💫

Kramar Clara och Barbie

IMG_5598

IMG_5588

IMG_5587IMG_5593

Gårdagens pass

Igår red jag Dewdrop på banan. Det gick faktiskt väldigt bra! När vi tömkörde visade instruktören mig hur det ska kännas när hon tar förhållningen på ytertygeln och hur lätt man ska vara. Försökte få in samma känsla igår också. Fick in det några stunder. Vi tränade mycket varvbyte och omställningar samt övergångar. På slutet blev hon riktigt mjuk och fin i sidorna.

Så här kommer resten av veckan se ut:

Tisdag: Vila

Onsdag:  Vila

Torsdag:  Träning för Cornelia

Fredag:  Träning på banan

Lördag:  Träning för Sandra och förberedelse för söndagens tävling

Söndag: Tävling!!!

//Emelie

IMG_7855 IMG_7859

Sommarbilder:

Eftersom att jag har lite sommarfeeling så kommer det lite sommar bilder från 2016, har redan börjat tagga för sommaren 2017:

IMG_5879 IMG_5243 IMG_5200 IMG_8697 IMG_5513 IMG_5318 IMG_5883

 

Hoppas att ni alla har haft en solig måndag!

Kramar Emelie och Dewdrop

Sommar och sol☀️

17 grader!

Snart får man börja plocka fram sommar kläderna och ta undan vinterjackan. Det ända som stör mig just nu är att det sägs ska snöa på onsdag. Kan det inte bara fortsätta vara så här tills sommarlovet?

Igår red jag ut en sväng. Så skönt att slippa alla dessa kläder. Även fast det blåste lite så var det fortfarande enormt skönt.

Idag blir det troligtvis ett pass på banan. Längtar tills våran utebana har torkat upp så man kan rida ute istället för inne!

Kramar Emelie

IMG_7853

Veckan!

Hej här är lite kort om min vecka! 👇🏼//Clara

Måndag: Hemma och plugga till ett ganska stort historia prov som vi har senare i veckan. 📝

Tisdag: Åka ner till stallet och kanske rida.🏇🐴

Onsdag: Somvanligt rida en annan familjs häst som står på ett annat stall.🏇🐴

Torsdag: Rida på banan för Cornelia.🏇🐴

Fredag: Åka till Täby med några kompisar och äta 🌮

Lördag: Först ett pass på banan för Sandra. Sedan stalljobb hela dagen.🏇🐴

Söndag: Tävlingsdags med division tre laget i Värmdö!🏇🐴💫

IMG_5569

En lungnare uteritt!

Halloj!

Idag vart det en mycket lugnare uteritt än förra veckans sväng. Mamma och min lillebror gick med ut då vi skulle bort under eftermiddagen då de andra hade tänkt att rida. Riktigt fint, soligt och varmt vårväder var det! Här kommer lite bilder  👇🏼

Hoppas ni har haft en bra dag i det fina vädret, //Clara och BarbieIMG_5543 IMG_5546 IMG_5556 IMG_5558 IMG_5570

Tömkörning!

Hej!

Som Emelie redan skrivit så var det tömkörningskurs både imorse ovh igår kväll. Det har varit riktigt kul att få lära sig så mycket på bara två dagar! Imorse fick vi även tessta att tömköra våra hästar som sagt. I början var Barbie både lite skeptisk och väldigt spänd. Men sedan släppte det och hon vart super fin och lugn. Både jag och Barbie tyckte att det var väldigt roligt med tömkörning och förhoppningsvis blir det lite mer tömkörning i framtiden. Har ni tömkört någon gång? Emelie hjälpte mig att filma mycket så här kommer ganska många bilder lite längre ner.

Imorgon blir det troligtvis en uteritt på förmiddagen, då jag ska bort till mina kusiner på eftermiddagen.

Kram Clara och Barbie

IMG_5518 IMG_5519 IMG_5520 IMG_5521 IMG_5522 IMG_5523 IMG_5524 IMG_5525 IMG_5526 IMG_5527 IMG_5528 IMG_5529 IMG_5530 IMG_5531 IMG_5532 IMG_5533 IMG_5534 IMG_5536 IMG_5537 IMG_5538 IMG_5539 IMG_5540